module Bio.Tools.Sequence.CodonOptimization.Types ( CodonScoreConfig(..) , Organism(..) , standardTemperature , defaultForbiddenRegexp ) where import qualified Data.ByteString.Lazy as BSL (ByteString) import Data.Default (Default (..)) import GHC.Generics (Generic) standardTemperature :: Double standardTemperature = 37 data Organism = CHO | EColi | Human deriving (Eq, Show, Generic) -- | all parameters for codon optimization data CodonScoreConfig = CodonScoreConfig { organism :: Organism , initLen :: Int -- ^ number of first ak from initial sequence, which will optimised without scoring function , windowLen :: Int -- ^ length of variation window , codonUsageWeight :: Double -- ^ Codon usage weight , gcWeight :: Double -- ^ GC-content weight , gcFactor :: Double -- ^ GC_score in the power of F_gc is used , gcWindow :: Int -- ^ length of the window for GC-score calculation (bp) , rnaFoldingWeight :: Float -- ^ Weight of the RNA folding score , rnaFoldingFactor :: Float -- ^ RNA folding score in the power of F_rnaf is used , rnaFoldingWindow :: Int -- ^ length of the window for RNA folding score calculation (bp) , forbiddenDNAWeight :: Double -- ^ forbidden DNA motifs score weight , gcContentDesired :: Int -- ^ desired gc content in percents , forbiddenSequence :: [BSL.ByteString] -- ^ list of forbidden patterns } deriving (Eq, Show, Generic) instance Default CodonScoreConfig where def = CodonScoreConfig CHO 3 1 1 0.5 1.4 40 0.001 2.6 100 1 43 defaultForbiddenRegexp defaultForbiddenRegexp :: [BSL.ByteString] defaultForbiddenRegexp = [ "ATTTA" , "ATACTCCCCC" , "CGATCG" -- PvuI , "GGGGACTTTGCACTGGAACTTACAACACCCCAGCAAGGACGCG" , "CCGGCGGGT" , "TTTATAATTTCTTCTTCCAGAA" , "CCGTGCTGGCGTCTG" , "AATAAA.{10,30}CA{30,}(TCTG|TG.CT)" , "(GGG|CCA)CGCCTATAAA(((C|T)(C|T)A.(T|A)(C|T)(C|T))|(TCA(G|T)T(T|C)))(A|G)G(A|T)(C|T)(G|A|C)" , "CAGG" , "(A|C)AGGT(A|G)AGT" , "AATAAA" , "GCC(A|G)CCATGG" ]